Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_103801 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Osteosarcoma | ICD-10 | Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41) |
DBLink | Link to database | PMID | 28957794 |
Experimental Method | |||
Sample Type | U2OS, MG63, HOS and 143B Cell lines | Comparison | human osteoblast hFOB1.19 and the human osteosarcoma cell lines U2OS, MG63, HOS |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward TCTGACAGCCCTGATAGGCA ReverseCATTGCCTTTGATCCTGCTGT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Liu, W, Zhang, J, Zou, C, Xie, X, Wang, Y, Wang, B, Zhao, Z, Tu, J, Wang, X, Li, H, Shen, J, Yin, J (2017). Microarray Expression Profile and Functional Analysis of Circular RNAs in Osteosarcoma. Cell. Physiol. Biochem., 43, 3:969-985. |